Scientific journal
Fundamental research
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,087

MOLECULAR IDENTIFICATION OF SPRING WHEAT GENOTYPES BY ALLELIC VARIANTS OF THE HMW GLUTENIN SUBUNITS

Abdulina I.R. 1, 2 Abdulina I.R. 1 Vafin R.R. 2 Tyulkin S.V. 1 Zaynullin L.I. 1 Alimova F.K. 3 Askhadullin D.F. 3 Askhadullin D.F. 3
1 Kazan (Volga region) federal university
2 Tatar trans-regional veterinarian laboratory
3 Tatar research institute of agriculture of RAAS
Целью настоящей работы являлась молекулярная идентификация перспективных генотипов яровой пшеницы селекции ТатНИИСХ по аллельным вариантам HMW субъединиц глютенинов и апробация разработанного нами способа проведения ПЦР-ПДРФ-генотипирования с электрофорезной детекцией в агарозном геле. В результате молекулярно-генетической оценки 70 образцов яровой пшеницы установлено, что 32 генотипа Triticum aestivum имеют ассоциированную с высокими качествами зерна комбинацию субъединиц Ax2*/5 + 10 и могут рассматриваться как наиболее перспективные генотипы для дальнейшей селекционной работы по созданию сортов с высокими мукомольно-хлебопекарными качествами зерна. При апробации предложенного способа проведения ПЦР-ПДРФ, отличающегося от прототипа дополнительным введением этапа ПДРФ-анализа, нами получен обеспечиваемый заявленным способом технический результат, выраженный в эффективной идентификации аллельных вариантов HMW-GS, ввиду корректной интерпретации генерируемых ПЦР-ПДРФ-фрагментов.
The aim of this study was a molecular identification of perspective spring wheat genotypes of the Tatar research institute of agriculture by allelic variants of HMW glutenin subunits and approbation of the PCR-RFLP genotyping method with detection by agarose gel electrophoresis developed by us. In result of the molecular-genetic evaluation of 70 samples of spring wheat was found that 32 Triticum aestivum genotypes are associated with high grain quality combination of Ax2*/5 + 10 subunits and can be considered as the most perspective genotypes for further breeding to create varieties with high flour and baking qualities of grain. When testing a proposed PCR-RFLP method which was differed from a prototype by introducing additional stage of the RFLP-analysis, we have obtained technical result expressed in effective identification of allelic variants of HMW-GS in view of the correct interpretation of the generated PCR-RFLP fragments.
HMW-GS
allele
genotype
wheat
identification
PCR
RFLP
1. Ghazy, A.I. Molecular screening of high molecular weight glutenin genes in spring bread wheat genotypes in Saudi Arabia / A.I. Ghazy, A.I. Zanouny, K.A. Moustafa, A.A. Al-Doss // Journal of Food, Agriculture & Environment. 2012. Vol. 10. no. 1. рр. 157–161.
2. Kocourkova Z. Wheat breeding for the improved bread-making quality using PCR based markers of glutenins / Z. Kocourkova, J. Bradova, Z. Kohutova, L. Slamova, P. Vejl, P. Horcicka // Czech J. Genet. Plant Breed. 2008. Vol. 44. no. 3. рр. 105–113.
3. Lafiandra, D. PCR analysis of x- and y-type genes present at the complex Glu-A1 locus in durum and bread wheat / D. Lafiandra, G.F. Tucci, A. Pavoni, T. Turchetta, B. Margiotta // Theor. Appl. Genet. 1997. Vol. 94. рр. 235–240.
4. Liu, S. New DNA markers for high molecular weight glutenin subunits in wheat / S. Liu, S. Chao, J.A. Anderson // Theor. Appl. Genet. 2008. Vol. 118. no. 1. рр. 173–183.
5. Moczulski M. Multiplex PCR identification of wheat HMW glutenin subunit genes by allele-specific markers / M. Moczulski, B.P. Salmanowicz // J. Appl. Genet. 2003. Vol. 44. no. 4. рр. 459–471.

Идентификация генотипов пшеницы по аллельным вариантам HMW субъединиц глютенинов является важным звеном в маркер-вспомогательной селекции сортов с высокими мукомольно-хлебопекарными качествами зерна [1, 2, 3, 4, 5].

Наиболее высокоточными подходами к оценке аллельного полиморфизма HMW субъединиц глютенинов служат способы идентификации на основе молекулярно-генетических методов исследования [1, 2, 3, 4, 5].

Так, одним из подходов к идентификации аллельных вариантов HMW-GS пшеницы является способ проведения ПЦР с праймерами: UMN19F + UMN19R (Ax1/Axnull- и Ax2*-аллели), UMN25F + UMN25R (Dx2- и Dx5-аллели) и UMN26F + UMN26R (Dy10- и Dy12-аллели) с последующей детекцией результатов реакции преимущественно методами капиллярного или вертикального гель-электрофореза в ПААГ [4].

Цель настоящей работы – молекулярная идентификация генотипов яровой пшеницы селекции ТатНИИСХ по аллельным вариантам HMW субъединиц глютенинов и апробация разработанного нами способа проведения ПЦР-ПДРФ-генотипирования с электрофорезной детекцией в агарозном геле.

Материалы и методы исследования

Молекулярно-генетическая оценка 70 образцов яровой пшеницы преимущественно селекции ТатНИИСХ на предмет идентификации генотипов по аллельным вариантам HMW субъединиц глютенинов (HMW-GS) проведена методами ПЦР- и ПЦР-ПДРФ-анализа на основе общеизвестного [4] и разработанного нами способов генотипирования.

Экстракция геномной ДНК из зерновок яровой пшеницы молочно-восковой спелости урожая 2012 г. осуществлена коммерческим набором «ДНК-сорб С» («ЦНИИ эпидемиологии», Россия).

Амплификация геномной ДНК проведена на термоциклере «PTC-200» (MJ Research) с использованием праймеров [4, 5], перечень которых представлен в табл. 1.

Таблица 1

Условия проведения ПЦР- и ПЦР-ПДРФ-анализа для идентификации аллельных вариантов HMW субъединиц глютенинов пшеницы

Праймеры

Последовательности праймеров (5/-3/)

Локус

(аллели)

Режим амплификации

ПДРФ-анализ

UMN19F

CGAGACAATATGAGCAGCAAG

Glu-A1

(Ax1/Axnull,

Ax2*)

×1:94 °С – 4 мин

×40:94 °С – 30 с, 60 °С – 30 с, 72 °С – 30 с

×1:72 °С – 5 м

HaeIII

37 °C – 2 часа

UMN19R

CTGCCATGGAGAAGTTGGA

UMN25F

GGGACAATACGAGCAGCAAA

Glu-D1

(Dx2, Dx5)

×1:94 °С – 4 мин

×40:94 °С – 30 с, 60 °С – 30 с, 72 °С – 30 с

×1:72 °С – 5 мин

HaeIII

37 °C – 2 часа

UMN25R

CTTGTTCCGGTTGTTGCCA

UMN26F

CGCAAGACAATATGAGCAAACT

Glu-D1

(Dy10, Dy12)

×1:94 °С – 4 мин

×40:94 °С – 30 с, 60 °С – 30 с, 72 °С – 30 с

×1:72 °С – 7 мин

HaeIII

37 °C – 2 часа

UMN26R

TTGCCTTTGTCCTGTGTGC

Axnull-F

ACGTTCCCCTACAGGTACTA

Glu-A1

(Axnull)

×1:94 °С – 4 мин

×40:94 °С – 1 мин, 58 °С – 1 мин, 72 °С – 1 мин

×1:72 °С – 7 мин

 

Axnull-R

TATCACTGGCTAGCCGACAA

Детекция результатов ПЦР- и ПЦР-ПДРФ-анализа выполнена методом горизонтального электрофореза в 3 % агарозном геле в буфере ТBE (рН 8,0), содержащем этидий бромид с последующей визуализацией результатов в ультрафиолетовом трансиллюминаторе (λ = 310 нм).

Размеры фрагментов ДНК оценены по подвижности в сравнении со стандартными ДНК маркерами. В работе использованы реактивы для молекулярно-биологических исследований производства ООО «СибЭнзим» (Россия).

Выравнивание частичных нуклеотидных последовательностей аллелей HMW субъединиц глютенинов: CLUSTAL W (v. 1.83). ПЦР-ПДРФ-моделирование: NEBcutter v.2.0.

Результаты исследования и их обсуждение

По результатам практических исследований, направленных на апробацию предложенного способа проведения ПЦР-ПДРФ, нами получен обеспечиваемый заявленным способом технический результат, выраженный в эффективной идентификации аллельных вариантов HMW-GS, ввиду корректной интерпретации при электрофорезной детекции в агарозном геле генерируемых ПЦР-ПДРФ-фрагментов (рис. 2, 4, 6), сопоставимых с расчетными данными (рис. 1, 3, 5).

Отличительным признаком предложенного способа генотипирования от прототипа [4] является дополнительное введение этапа ПДРФ-анализа с эндонуклеазным расщеплением ампликонов рестриктазой HaeIII с последующей детекцией результатов анализа методом горизонтального электрофореза в агарозном геле.

В результате молекулярно-генетической оценки на предмет идентификации генотипов по аллельным вариантам Glu-A1-локуса HMW субъединиц глютенинов установлено, что из 70 происследованных образцов яровой пшеницы 13 растений (18,6 %) имели субъединицу Ax1, кодируемую аллельным вариантом Glu-A1a (Ax1-аллель), а 57 образцов (81,4 %) – субъединицу Ax2*, кодируемую аллельным вариантом Glu-A1b (Ax2*-аллель) (табл. 2).

При оценке этих же образцов яровой пшеницы по Glu-D1-локусу HMW-GS выяснено, что 44 растения (62,9 %) характеризовались наличием комбинации субъединиц Dx5 и Dy10 (5 + 10), кодируемой аллельным вариантом Glu-D1d (Dx5- и Dy10-аллели), а 26 образцов (37,1 %) имели комбинацию субъединиц Dx2 и Dy12 (2 + 12), кодируемую аллельным вариантом GluD1a (Dx2- и Dy12-аллели) (см. табл. 2).

Распределение же исследуемых генотипов по совокупной комбинации Glu-A1-/Glu-D1-локусов HMW субъединиц глютенинов было следующим: Ax1/5 + 10 = 12 (17,1 %); Ax1/2 + 12 = 1 (1,4 %); Ax2*/5 + 10 = 32 (45,7 %); Ax2*/2 + 12 = 25 (35,7 %) образцов яровой пшеницы; с преобладанием желаемой для селекции на мукомольно-хлебопекарные качества зерна комбинацией субъединиц Ax2*/5 + 10.

pic_90.tif

Рис. 1. Выравнивание фланкируемых с праймерами UMN19F + UMN19R нуклеотидных последовательностей Ax1-, Axnull- и Ax2*-аллелей Glu-A1-локуса HMW субъединиц глютенинов пшеницы, HaeIII-рестрикционное картирование и моделирование HaeIII-ПЦР-ПДРФ-профилей

pic_91.tif

Рис. 2. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры UMN19F + UMN19R) для идентификации аллельных вариантов (Ax1/Axnull и Ax2*) HMW субъединиц глютенинов пшеницы

Обозначения: М) ДНК-маркеры 100 bp (СибЭнзим). 1-4) HaeIII-ПЦР-ПДРФ-анализ (предложенный способ): 1-2) Ax2*-аллель (172/153/19 bp); 3-4) Ax1/Axnull-аллели (172/171/19 bp). 5-8) ПЦР-анализ (прототип): 5-6) Ax2*-аллель (344 bp); 7-8) Ax1/Axnull-аллели (362 bp).

pic_92.tif

Рис. 3. Выравнивание фланкируемых с праймерами UMN25F + UMN25R нуклеотидных последовательностей Dx2- и Dx5-аллелей Glu-D1-локуса HMW субъединиц глютенинов пшеницы, HaeIII-рестрикционное картирование и моделирование HaeIII-ПЦР-ПДРФ-профилей

pic_93.tif

Рис. 4. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры UMN25F + UMN25R) для идентификации аллельных вариантов (Dx2 и Dx5) HMW субъединиц глютенинов пшеницы

Обозначения: М) ДНК-маркеры 100 bp (СибЭнзим). 1-4) HaeIII-ПЦР-ПДРФ-анализ (предложенный способ): 1-2) Dx2-аллель (171/109/19 bp); 3-4) Dx5-аллель (171/91/19 bp). 5-8) ПЦР-анализ (прототип): 5-6) Dx2-аллель (299 bp); 7-8) Dx5-аллель (281 bp).

Заключение

Учитывая общеизвестный факт положительного влияния аллельных вариантов Glu-D1d и Glu-A1b на повышение мукомольно-хлебопекарных качеств и отрицательного влияния аллельных вариантов Glu-D1a и Glu-A1a HMW-GS, приводящих к снижению хлебопекарных свойств пшеницы, можно констатировать, что из 70 исследованных образцов яровой пшеницы 32 генотипа Triticum aestivum имеют ассоциированную с высокими качествами зерна комбинацию субъединиц Ax2*/5 + 10 и могут рассматриваться как наиболее перспективные генотипы для дальнейшей селекционной работы по созданию сортов с высокими мукомольно-хлебопекарными качествами зерна.

pic_94.tif

Рис. 5. Выравнивание фланкируемых с праймерами UMN26F + UMN26R нуклеотидных последовательностей Dy10- и Dy12-аллелей Glu-D1-локуса HMW субъединиц глютенинов пшеницы, HaeIII-рестрикционное картирование и моделирование HaeIII-ПЦР-ПДРФ-профилей

pic_95.tif

Рис. 6. Электрофореграмма технического результата предложенного способа проведения ПЦР-ПДРФ и прототипа в постановке ПЦР (праймеры UMN26F + UMN26R) для идентификации аллельных вариантов (Dy10 и Dy12) HMW субъединиц глютенинов пшеницы

Обозначения: М) ДНК-маркеры 100 bp (СибЭнзим). 1-4) HaeIII-ПЦР-ПДРФ-анализ (предложенный способ): 1-2) Dy12-аллель (241/174 bp); 3-4) Dy10-аллель (223/174 bp). 5-8) ПЦР-анализ (прототип): 5-6) Dy12-аллель (415 bp); 7-8) Dy10-аллель (397 bp).

Таблица 2

Молекулярно-генетическая оценка образцов яровой пшеницы на предмет идентификации генотипов по HMW субъединицам глютенинов

№ п/п

Сорт/линия

HMW-глютенины

№ п/п

Сорт/линия

HMW-глютенины

Glu-D1-локус

Glu-A1-локус

Glu-D1-локус

Glu-A1-локус

5 + 10

2 + 12

Ax1

Ax2*

5 + 10

2 + 12

Ax1

Ax2*

1

Казанская

Юбилейная

+

+

36

К-27/00-2

+

+

2

К-109/02-5

+

+

37

К-23/00-3

+

+

3

Экада 97

+

+

38

К-414/01-1

+

+

4

К-100/03-2

+

+

39

К-21/00

+

+

5

К-18/03-8

+

+

40

К-58/01-2

+

+

6

К-68/04-5

+

+

41

K-48/04-2

+

+

7

К-130/04-10

+

+

42

K-106/01-2

+

+

8

Злата

+

+

43

K-101/04-3

+

+

9

К-88/02-19

+

+

44

K-112/04-2

+

+

10

К-6/01-2

+

+

45

K-134/04-19

+

+

11

К-5/03-6

+

+

46

К-51/00-3

+

+

12

К-48/03

+

+

47

K-133/05-5

+

+

13

К-100/03-8

+

+

48

K-57/05-6

+

+

14

К-21/02-5

+

+

49

К-117/04-4

+

+

15

К-46/04-9

+

+

50

К-12/04

+

+

16

К-68/04-1

+

+

51

К-99/05-2

+

+

17

К-23/04-1

+

+

52

Кк-8/06-1

+

+

18

К-49/04

+

+

53

Кк-71/06-3

+

+

19

К-7/04-2

+

+

54

Кк-8/06-6

+

+

20

Экада 113

+

+

55

Кк-75/06-3

+

+

21

Экада 109

+

+

56

Кк-11/06-11

+

+

22

К-93/05-2

+

+

57

Кк-11/06-10

+

+

23

К-29/02-5

+

+

58

Кк-69/06-4

+

+

24

К-109/02-13

 

+

+

59

Кк-6/07-2

+

+

25

К-20/02-2

+

+

60

Кк-69/06-1

+

+

26

К-73/03-4

+

+

61

Кк-71/06-8

+

+

27

К-68/04-4

+

+

62

Кк-75/06-5

+

+

28

К-100/03-9

+

+

63

О-192/03-5

+

+

29

К-7/04-1

+

+

64

О-25/05-2

+

 

+

30

К-65/05-2

+

+

65

О-206/05-2,

д.515-10

+

+

31

К-11/04-8

+

+

66

О-186/04-1

+

+

32

Экада 66

+

+

67

О-464/02-2

+

+

33

Казанская

Юбилейная

(неполег.)

+

+

68

О-513/00-21

+

+

34

К-65/05-1

+

+

69

Эр.255/00-3-1

+

+

35

Симбирцит

+

+

70

О-28/05-2

+

+

Примечание:

+

‒ наличие соответствующих субъединиц HMW-глютенинов

 

‒ отсутствие соответствующих субъединиц HMW-глютенинов

Выражаем благодарность Вафину Ришаду Абдулфартовичу за оказанную финансовую поддержку.

Рецензенты:

Абрамова З.И., д.б.н., профессор кафед­ры биохимии Института фундаментальной медицины и биологии Казанского (Приволжского) федерального университета, г. Казань;

Багаева Т.В., д.б.н., профессор, зав. кафедрой биотехнологии Института фундаментальной медицины и биологии Казанского (Приволжского) федерального университета, г. Казань.

Работа поступила в редакцию 14.02.2013.