Scientific journal
Fundamental research
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,749

CHARACTERISTIC OF RAT’S BEHAVIOR WHICH ARE DIFFER IN GENOTYPE LOCUS TAG 1A OF GENE RECEPTOR OF DOPAMINE SECOND TYPE IN ELEVATED CRUCIFORM LABYRINTH TEST

Н.Ф. Леушкина, А.В. Ахмадеев, Л.Б. Калимуллина
In this work firstly gives data about peculiarities of behavioral reactions in two groups of rats, which are homozygous in biallele locus TAG 1A DRD2. in elevated cruciform labyrinth test.

Участие дофаминергической системы мозга в реализации многообразных функций объясняет ее вовлечение в патогенез многих психоневрологических заболеваний, включая и социально значимые, к которым относится эпилепсия. Эпилепсия является наиболее распространенным заболеваниям нервной системы, так как заболеваемость ею составляет 50-70 случаев на 100 тыс. человек, у 20-30% больных заболевание является пожизненным.

Крысы линии WAG/Rij являются инбредной линией с генетически детерминированной абсансной эпилепсией. Они широко используются в качестве адекватной модели для изучения механизмов генерализованной абсансной эпилепсии человека [4], причины возникновения которой остаются до настоящего времени неизвестными. Важным звеном в патогенезе абсансной эпилепсии является дефицит дофаминергической системы, при этом ведущее значение имеет изменение уровня функционирования дофаминовых рецепторов второго типа (DRD2) [5].

Целью данной работы является характеристика поведения двух групп крыс линии WAG/Rij, различающихся генотипом по локусу TAG 1A гена DRD2, в установке «приподнятый крестообразный лабиринт» (ПКЛ). ПКЛ является наиболее признанным тестом при оценке уровня тревожности у грызунов [1,7,10] и часто используется при изучении анксиолитиков. Основанием для проведения эксперимента послужили результаты тестирования поведения этих крыс в «открытом поле», показавшие у них признаки тревожного поведения [2].

Для генетического анализа ДНК (анализ выполнен совместно с Э.К. Хуснутдиной и А Галеевой) была выделена из лимфоцитов периферической крови. Для получения ДНК использовали метод Мэтью [8]. Для этого кровь с консервантом в пробирке тщательно перемешивали и переливали в 100 мл центрифужный стакан, туда же добавляли 50 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1%-ный раствор тритона Х-100, 5 мМ MgCl2, 10мМ трис HCl, pH 7,6. Смесь центрифугировали 20 мин. при 4000 об./мин. Надосадочную жидкость сливали, а к получившемуся осадку приливали 8 мл буфера ЭДТА(25 мМ ЭДТА, 75 мМ NaCl), pH 8.0, суспендировали. К суспензии добавляли 0,8 мл 10% SDS и протеинкиназу К (10мг/ мл). Смесь для лизиса оставляли на ночь в термостате при температуре 42° С. Экстракцию ДНК осуществляли в следующем порядке: 1.Для депротеинизации к лизату добавляли 0,5 мл 5М перхлората натрия и 8 мл фенола, насыщенного 1М трисHCl до pH 7.8; 2.Смесь центрифугировали при 3000 об./мин. в течение 10 мин.; 3.Отбирали водную фазу, содержащую ДНК, РНК и неденатурированные белки; 4. Отобранную фазу обрабатывали смесью фенол-хлороформа (1:1), а затем хлороформом; 5. Препараты осаждали двумя объемами 96% этанола; 6. Образовавшийся осадок ДНК растворяли в 1,5 мл деионизированной воды; раствор хранили при -20° С. Амплификацию локуса TAG 1a DRD2 проводили с помощью метода полимеразной цепной реакции синтеза ДНК (ПЦР) на амплификаторе «Терцик» производства г.Пущино с использованием ДНК-полимеразы Termus aguaticus производства фирмы «Биотекс» (Москва). Реакционная смесь для амплификации состояла: из 0,1-1 мкг геномной ДНК, 0,25 мкМ каждого олигопраймера, 250 мкМ каждого дезоксинуклеозидтрифосфата помещали в 25 мкл однократного буфера для ПЦР следующего состава: 67 мM трисHCl, pH 8.8, 6,7 мМ MgCl2, 16,6 мМ (NH4)2SO4, 0,01% Tween-20.

ПЦР локуса TAG 1A (локализован в 3´- некодирующем регионе) DRD2 проводили с использованием олигонуклеотидных праймеров:

5´ CTGGGTATCGTCCACCTTCT 3´

5´ AACACTGCTACACCTAATCATCCA 3´, подобранных с помощью программы Primer 3 (http://frodo.wi.edu/primer3).

После денатурации (3 мин. при 94°С) выполняли 35 циклов амплификации по схеме: отжиг праймеров - 1 мин. при 58°С, синтез ДНК - 1 мин. при 72°С, денатурация - 1 мин. при 94°С. Затем пробы выдерживали 10 мин. при 72°С, охлаждали [6]. Для выявления полиморфизма 10 мкл реакционной смеси обрабатывали 5 единицами рестриктазы TAG 1A. В результате реакции аллель А1 локуса TAG 1A длиной 295 пар оснований оставался интактным, а аллель А2 подвергалась ферментативному гидролизу. Длины фрагментов аллеля А2 были равны 119 и 176 парам оснований.

Результаты амплификации оценивали в полиакриламидном геле (ПААГ). Для разделения амплифицированных фрагментов использовали 7%-ный гель [3]. Для заливки ПААГ готовили раствор, состоящий из 5,5 мл 30%-ного раствора акриламида, 2,5 мл 10*трис-боратного буфера - ТBE и 17 мл дистиллированной воды. Непосредственно перед заливкой геля в раствор добавляли 29 мкл 10%-ного персульфата аммония и 15 мкл N,N,N´,N´ тетраметилэтилендиамина - ТЕМЕД. ПААГ заливали между двумя стеклами, разделенными прокладками и гребенкой, и оставляли для полимеризации на 20 мин. Затем вынимали гребенку, промывали образовавшиеся лунки водой и помещали гель в вертикальную электрофорезную камеру. В качестве электрофорезного буфера использовали 1*ТВЕ. Проводили префорез в течение 20 минут.

Пробы для нанесения в гель готовили следующим образом: 10 мкл амплификата смешивали с 2 мкл краски (смесь бромфенолового синего и ксилолцианола). Наносили приготовленные пробы в лунки и проводили электрофорез в течение 1,5 часов при 300 В. В качестве маркера молекулярного веса использовали 2-Log Ladder (0,1 - 10,0 кб) (New England Biolabs, США). После окончания электрофореза гель окрашивали раствором бромистого этидия и визуализировали в проходящем ультрафиолетовом свете. Документирование результатов электрофореза проводили с использованием видеосистемы «Geldokulant» (Франция).

ПКЛ, использованный в работе, представлял собой установку, имеющую два рукава, в месте пересечения которых находилась открытая площадка. Один из рукавов лабиринта имел закрытые отсеки. Лабиринт устанавливали на высоте одного метра от пола. Изучая поведение крыс, мы регистрировали в течение пяти дней ряд параметров: количество посещений и время пребывания в открытых и закрытых рукавах, количество стоек в открытом и закрытом рукавах, количество свешиваний с открытого рукава, число эпизодов и продолжительность груминга, общую неподвижность, количество болюсов. Полученные результаты систематизировали и подвергали статистической обработке с помощью пакета программ «Statistica 5,5».

Поведенческие реакции изучены у 121 крысы, 75 которых имели генотип А1/А1 по локусу TAG 1a DRD2 (далее в работе они будут обозначены как группа А1А1), 46 - с генотипом А2/А2 по тому же локусу (группа А2А2).

Полученные результаты приведены в таблицах 1 и 2.

Таблица 1

Показатели предпочтения крысами открытого или закрытого рукавов лабиринта и груминга 

Группы крыс

Количество посещений

Время пребывания

Груминг (длительность)

ОР

 ЗР

ОР

ЗР

ОР

ЗР

А1А1

4,10

+0,16

4,27

+0,16

147,89

 +5,33

152,11

+5,20

1,85

+0,28

4,19

+0,78

А2А2

0,96

 +0,21

1,38

+0,20

90,26

+7,53

209,74

+7,52

2,38

+0,33

4,38

+0,47

p

<0,001

<0,001

<0,001

<0,001

>0,05

>0,05

Обозначения: ОР - открытый рукав (светлый отсек); ЗР - закрытый рукав (темный отсек)

Приведенные в табл. 1 данные показывают, что животные, гомозиготные по аллелю А2 в локусе TAG 1A DRD2 по сравнению с другой группой (А1А1), в четыре раза меньше посещают как открытые, так и закрытые рукава. При этом время, проведенное ими в закрытом рукаве, в два раза больше, чем в открытом, т.е. меньше перемещаясь по сравнению с крысами А1А1 из одного рукава в другой, они надолго остаются в закрытом рукаве. Если рассчитать время, проведенное крысами А2А2 в закрытом рукаве на одно его посещение, оно окажется примерно равным 152 секундам, в то время как этот же показатель в отношении светлого отсека значительно меньше и равен 94 секундам. Различия по времени пребывания крысами группы А2А2 в открытом и закрытом рукавах высокозначимы (p<0,001).

Таблица 2

Показатели исследовательской деятельности крыс в приподнятом крестообразном лабиринте 

Группы крыс

Количество вертикальных стоек в рукавах

Количество свешиваний в ОР

открытый

 закрытый

А1А1

6,14+0,42

7,63+0,43

14,26+0,68

А2А2

3,53+0,57

5,33+0,34

6,07+0,61

p

<0,001

<0,001

<0,001

Подобный анализ в отношении крыс А1А1 показывает, что среднее время их пребывания в открытом и закрытом рукавах на одно его посещение равно между собой и составляет 36 секунд. Статистический анализ вариационных рядов, выстроенных по численным характеристикам количества посещений светлого и темного отсеков лабиринта, а также по времени, проведенному в них, показывает отсутствие значимых различий, так как критерий Стьюдента в обоих случаях соответственно составляет t=0,73, p=0,46 и t=0,78, p=0,44. Полученные данные позволяют указать на интересную особенность поведения крыс А1А1, а именно: отсутствие у них «способности» различать темный и светлый отсеки лабиринта, посещение которых напоминает челночные движения из одного в другой. Можно было бы предположить, что отмеченный феномен связан с нарушениями в светочувствительности сетчатки глаза этих крыс (известно, что у крыс линии WAG/Rij может иметь место пигментная ретинопатия [9]. Однако против этого говорит выявленный в работе факт предпочтения для проведения груминга крысами А1А1 закрытого рукава лабиринта (p<0,001, см.ниже). Поэтому следует думать, что высокая локомоторная активность крыс А1А1 связана с особенностями процессов дофаминергической трансмиссии. Паттерн поведения крыс А1А1 напоминает картину, описанную в литературе как синдром гиперактивности/дефицита внимания, который часто встречается в детском возрасте и объясняется как следствие нарушений, предопределенных генетическими факторами в функционировании особых белков - переносчиков дофамина [11].

Сравнение длительности и количества эпизодов груминга у крыс А1А1 и А2А2 не выявило статистически значимых различий, но обращало на себя внимание явная тенденция, общая для обеих групп крыс, проводить груминг в закрытом рукаве. Проведенное сравнение по показателям груминга внутри групп изучаемых крыс показало, что по выраженности «чесательного» рефлекса в открытом и закрытом рукавах ПКЛ в каждой группе крыс существуют значимые различия (у крыс А1А1 при р<0,05, у крыс А2А2 при р<0,01). Это указывает на то, что темный отсек является более комфортным для реализации «чесательного рефлекса».

Показателями исследовательской деятельности в приподнятом крестообразном лабиринте являются как количество совершаемых животными стоек, так и процедура свешивания крысы с открытого рукава, когда она с высоты, на которой находится лабиринт, осматривает пространство, расположенное под рукавом лабиринта. Учитывая существующую у крыс боязнь высоты, этот же показатель может рассматриваться и как проявление меньшей тревожности. Эти данные в сравнительном аспекте в отношении двух групп крыс отражены в табл. 2.

Из данных табл. 2 следует, что крысы А1А1 проявляют большую исследовательскую активность по сравнению с крысами А2А2 как в закрытых, так и в открытых рукавах (p<0,001). Кроме того, выявлены высокозначимые различия между изучаемыми группами крыс и по показателю «свешивания в открытом рукаве» лабиринта. Если рассматривать этот показатель в аспекте проявления тревожности, то можно сказать, что крысы А2А2 значительно более тревожны по сравнению с крысами группы А1А1. Анализ показателей поведения крыс в ПКЛ внутри изучаемых групп по выраженности исследовательской деятельности показал, что она более ярко проявляется в закрытом рукаве (темном отсеке), при этом выявленные различия значимы у крыс А1А1 при р<0,05, у крыс А2А2 при р<0,01.

Итак, полученные в работе данные показывают большую тревожность крыс с генотипом А2/А2 по сравнению с крысами с генотипом А1/А1 по локусу TAG 1A DRD2.

Список литературы

  1. Дыгало Н.Н. // Успехи физиол. наук. - 2007, Т. 38, № 1. - С. 3.
  2. Леушкина Н.Ф., Калимуллина Л.Б. // Успехи современного естествознания. - 2008. - №9, С. 10.
  3. Маниатис Т., Фрич Э., Сэмбрук Дж. Методы генетической инженерии. Молекулярное клонирование. - М.: Мир, 1984. - 399 c.
  4. Меерен Х.К.М., ван Луителаар Е.Л.Дж., да Сильва Ф.Х.Лопес и др.// Успехи физиологических наук. - 2004. - Т. 35, № 1. - С. 3.
  5. Мидзяновская И.С., Кузнецова Г.Д., Туомисто Л. и др. // Нейрохимия. - 2004, Т. 21, № 4. - С.264.
  6. Chen W.J., Lu M.-L., Hsu Y.-P. et al. // American Journal of Medical Genetics. - 1997. V. 74. - P. 129.
  7. Holmes A. // Neuirosci Biobehav Rev. - 2001, V. 25. - P. 261.
  8. Mathew С. Methods in Molecular Biology / Ed. Walker J.M. - New York.: Human Press, 1984. - V. 2. - P. 31.
  9. O´Steen W.K., Donnelly J.E. // Invest Ophthalmol Vis. Sci. - 1982. - V. 22. - N 252. - P. 5.
  10. Pellow S., Chopin P., File S.E. et al. // J. Neurosci Methods. - 1985. - V. 14. - P. 149.
  11. Steyaert J., Devriendt K., Fryns J. // Am. J. Med. Genet. - 1997. - V. 74, - N 6. - P. 656.