Scientific journal
Fundamental research
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,222

MOLECULAR MECHANISM OF ALKALINE STRESS ADAPTATION IN YEAST YARROWIA LIPOLYTICA

Гусева М.А., Эпова Е.Ю., Осипенкова О.В., Елагина Е.М., Шевелев А.Б.
С использованием репортёрных конструкций на основе гена бета-галактозидазы установлено, что адаптация дрожжей Yarrowia lipolytica к росту при щелочных значениях рН внешней среды вне зависимости от используемого клеткой источника энергии сопровождается повышенной экспрессией гена митохондриального фермента – альфакетоглутаратдегидрогеназы, но не влияет на экспрессию гена Na-зависимой АТФазы внешней мембраны. На этом основании высказано предположение о существенной роли митохондрий в способности Y. lipolytica к росту на средах с высокими значениями рН, не свойственной другим видам дрожжей-аскомицетов.
Using transcriptional reporter constructs with beta-galactosidase, adaptation of yeast Yarrowia lipolytica to alkaline pH of the culture medium was found to be accompanied with super-expression of oxoisovaleratedehydrogenase gene (mitochondrial enzyme) but not with Na-dependent ATPase (key plasma membrane protein). This effect did not depend on energy source used with the yeast culture. Taken together, these observations allowed us to speculate about key role of mitochondria in Y. lipolytica unique ability to growth at alkaline media, not found in other ascomycetes yeast. Keywords: yeast, mitochondria, oxoisovaleratedehydrogenase, ATPase, Na, beta-galactosidase, transcriptional reporter, Yarrowia lipolytica

В последнее десятилетие вид дрожжей-аскомицетов Yarrrowia lipolytica (Candida lipolytica, Saccharomycopsis lipolytica) рассматривается в качестве перспективного объекта биотехнологии, на основе которого создаются продуценты рекомбинантных белков (липазы, фитазы) и низкомолекулярных метаболитов (сукцинат) [3]. Важной для биотехнологического применения особенностью Y. lipolytica является способность с высокой скоростью утилизировать экономически доступные субстраты самого разнообразного состава (нефтяные парафины, грубые гидролизаты биомассы, промышленные стоки), накапливая при этом большое количество биомассы. Кроме того, Y. lipolytica обладает способностью к высокоэффективной секреции белков во внешнюю среду (до 10 г/л), что значительно превышает возможности пекарских дрожжей Saccharomyces cerevisiae и приближается к секреторному потенциалу метилотрофных дрожжей родов Pichia и Hansenula [3]. Однако наиболее яркой чертой этого вида является уникальная для дрожжей способность не только выдерживать щелочной стресс, но и эффективно расти на средах со щелочными значениями рН - вплоть до 10,5 [7]. Y. lipolytica свойственна также высокая галотолерантность [7]. Традиционно механизмы адаптации Y. lipolytica изучалась на уровне глобальных регуляторов транскрипции (белки Rim101 и Rim9) [2, 8]. Выдвинута также гипотеза о том, что эффективная адаптация Y. lipolytica к щелочным условиям среды обусловлена ее способностью замещать систему протон-зависимого симпорта метаболитов через плазматическую на аналогичную Na+-зависимую систему. Эти выводы основаны на исследованиях регуляторных белков, однако до настоящего времени они не подтверждены прямыми данными об изменении содержания наиболее массовых белков в клетках Y. lipolytica при изменении рН внешней среды [7].

Охарактеризована комплексная регуляция экспрессии ENA1 в условиях солевого стресса. Наличие глюкозы в среде репрессирует экспрессию ENA1 по механизму, включающему Snf-киназу и репрессорный комплекс Mig1-Ssn6-Tup1, который связывается с MIG-элементом, расположенным в позиции -534/-544 в ENA1-промоторе [6]. Помимо снятия репрессорного комплекса, индукция ENA1 высокими концентрациями солей включает, как минимум, три различных пути. Активация HOG-пути в ответ на высокую осмолярность идет через фосфорилирование и активацию Hog-1-зависимой митоген-активируемой киназы, которая мигрирует в ядро и фосфорилирует репрессор Sko1 [9]. Фосфорилирование Sko1 предотвращает его связывание с сАМР-чувствительным элементом промотора, расположенным в позициях -502/-509. Активация промотора ENA1 высокой концентрацией солей обусловлена также функционированием кальциневринового пути (9-15). Активация кальциневрина усиливает транскрипцию ENA1 через дефосфорилирование и активацию Crz1/Tcn1/Hal8 транскрипционного фактора [6], который связывает специфические последовательности ДНК (элементы кальциневрин-зависимого ответа). В случае промотора ENA1имеются два таких элемента в позициях -813/-821 и -719/-727, причем ближний к старту транскрипции элемент более важен для транскрипционного ответа на солевой стресс [5]. Наконец, доказана роль TOR-пути в регуляции экспрессии ENA1. В этом случае солевой стресс ингибирует TOR-путь, вследствие чего транскрипционные факторы Gln3 и Gat1 перестают задерживаться в цитоплазме, а быстрее переходят в ядро, где активируют промотор ENA1, предположительно, связываясь с различными GATA-последовательностями [5].

Ранее методом протемного анализа мы показали, что одним из наиболее массовых белков, накапливающихся в клетках Y. lipolytica при росте в щелочных условиях среды, является митохондриальный фермент цикла Кребса a-кетоглутаратдегидрогеназа [1].

Целью настоящей работы было сравнительное изучение изменений уровня экспрессии гена α-кетоглутаратдегидрогеназы Y. lipolytica при росте на средах с рН 5,0 и 8,5. С целью выявления степени универсальности клеточного ответа именно по отношению к рН проводилось варьирование состава среды по солевому составу и набору усвояемых органических веществ. Для облегчения решения поставленной задачи была создана и введена в геном Y. lipolytica репортёрная конструкция на основе гена lacZ с промотором гена KGDH. Для сравнения были получены и охарактеризованы аналогичные конструкции без промотора и с промоторами гена Na-зависимой АТФазы ENA1 и синтетического производного промотора гена щелочной протеазы HP4d.

Материалы и методы исследования

В работе использован штамм Y. lipolytica PO1f (MatA, leu2-270, ura3-302, xpr2-322, axp-2), полученный из коллекции типовых штаммов CIRM-Levures (Франция), где он депонирован под номером CLIB-724. Фенотипическими проявлениями имеющихся в штамме мутаций (отличающих его от дикого типа) является неспособность расти на средах, не содержащих лейцина и урацила, а также способность утилизировать сахарозу.

Поддержание штаммов и отбор трансформантов проводили на синтетической агаризованной среде YNB следующего состава (г/л): MgSO4, - 0,5, (NH4)2SO4 - 0,3, KH2PO4- 2, K2HPO4 - 0,5, NaCl - 0,1, CaCl2- 0,05, глюкоза - 20, агар - 20, KOH или H2SO4 - по показаниям рН-метра, 2,5M Tris-сукцинат (рН 8,5 или 4,5) - 50 мМ. В среде присутствовали также добавки. Микроэлементов (мг/мл): KI - 0,2; CuSO4×5H2O - 0,08; MnSO4 0,08; FeCl3⋅6H2O - 0,4; Na2MoO4⋅2H2O - 0,4; ZnSO4⋅7H2O - 0,08; H3BO3 -1; витаминов (мг/мл): биотин - 0,00002; фолиевая кислота - 0,02; пантотенат кальция - 0.6; инозит - 3; никотиновая кислота - 0,6; пара-аминобензойная кислота - 0,3; пиридоксин-HCl - 0,6; рибофлавин - 0,3; тиамин-HCl - 0,15.; аминокислот и нуклеотидов (мкг/мл): лейцин - 60, урацил - 40. Клетки выращивали в течение 20‒30 часов при +28 °С.

Физиологические эксперименты по определению b-галактозидазной активности рекомбинантных штаммов проводили на жидких средах следующего состава (pH доводили внесением 1 М H2SO4 или 1 М КОН до 5.0 и 8.5):

Среда I -  YNB с 1 % глицерином;

Среда II - YNB с 1 % глицерином + 0,5 M NaCl;

Среда III - YNB с 2 % глюкозой и 2 % протеозным пептоном (Merck);

Среда IV - 2 % глюкозы и 2 % пептона без добавления солей;

Среда V - YNB, разбавленная в 2 раза, с 2 % глюкозы и 2 % пептон;

Среда VI - 2 % глюкозы, 1 % дрожжевого экстракта (Panreac) и 2 % пептон.

Инокулят для проведения основного физиологического эксперимента получали на «Среде III» культивированием клеток в течение 24 часов, причем для каждого эксперимента готовили два варианта сре-
ды - с рН 5,0 и 8,5. Во всех случаях pH среды, используемой для основного физиологического эксперимента, совпадал с рН 5,0 среды, на которой получали инокулят. Для проведения основного физиологического эксперимента свежую среду в объеме 5 мл засевали с начальной плотностью инокулята 103 КОЕ/мл, после чего выращивали в течение 36 часов при +28 °С при интенсивной аэрации.

Получение интегративных репотёрных генетических конструкций на основе гена lacZ

Для клонирования гена lacZ из генома E. coli С600 с помощью ПЦР были использованы праймеры Lac-for1 (SalI) GGGTCGA CACCATGATTACGGATTCACTG и Lac-rev1 (HindIII) GGAAGCTTATTTTTGACACCAGACCAACTG. Полученный продукт размером 3100 п.н. по сайтам SalI-HindIII клонировали в вектор pQE30 (Qiagen). После этого в состав конструкции по сайтам XhoI-EcoRI был введен маркер прототрофности URA3 из Y. lipolytica. Полученная конструкция pQE30-LacZ служила для встраивания тестируемых промоторов ENA, KGDH и HP4d, а также была введена в состав Y. lipolytica штамма Po1f для получения контрольного штамма, использованного в физиологических экспериментах.

Промотор гена альфа-кетоглутаратдегидрогеназы KGDH клонировали с помощью ПЦР на матрице геномной ДНК Y. lipolytica штамма Po1f с праймерами KGDH1 (XbaI) ACCTCTAGATGGC
TTATTTGCAACCGAAC и KGDH2 (BamHI) GGGGATCCGTGGTTGGTGATGTCAGAAG. Продукт ПЦР размером 772 п.н. клонировали в вектор pUK-tg131 по сайтам XbaI-BamHI. Из промежуточной конструкции промотор вырезали по сайтам EcoRI-BamHI и клонировали в вектор pQE30-URA3, из которого затем получали репортёрную конструкцию
pQE-KGDH-LacZ.

Промотор гена Na-зависимой АТФазы ENA1 получен с помощью ПЦР на матрице геномной ДНК Y. lipolytica штамма Po1f с праймерами ENA1 (EcoRI) GGGAATTCAATTCAATTAAATTAA и ENA2 (BamHI) GAGGATCCATTTTTCTCAGA CATGTTTT. Продукт ПЦР размером 758 п.н. клонировали в вектор pQE30-LacZ, получив в результате репортёрную конструкцию pQE-ENA-LacZ.

Промотор HP4d, синтезированный согласно работе [8], был любезно предоставлен Т.В. Юзбашевым и И.А. Лаптевым в составе вектора pUC19-HP4d. Его переносили по сайтам в виде фрагмента длиной 585 п.н. в вектор pQE30-LacZ, получив в результате репортёрную конструкцию pQE- HP4d-LacZ.

Определение активности b-галактозидазы

Для определения активности LacZ в клетках рекомбинантных штаммов Y. lipolytica немедленно по окончании ферментации их осаждали центрифугированием на настольной центрифуге в течение 1 мин при 8000 об./мин из объема 1.5 мл. Супернатант удаляли, а к осадку клеток добавляли 1 мл буфера состава Трис-HCl 50 мМ, pH 8,5, ЭДТА 10 мМ. Клеточную суспензию охлаждали на льду до 0 ° и обрабатывали ультразвуком на приборе SoniPrep150 три раза по 2 минуты. Оставшийся нерастворимый осадок отделяли центрифугированием на настольной центрифуге в течение 10 мин при 12000 об./мин. В супернатанте определяли общий белок по модифицированному методу Лоури с бицинхониновым реагентом [Redinbaugh M.G., 1986].

Для определения активности из осветлённого клеточного лизата отбирали объем, содержащий 10 мкг общего белка, и вносили в лунку 96-луночного иммунологического планшета Nunc (LowSorp), содержащую 100 мкл субстратной смеси (0,3 % X-gal (MBI Fermentas), свежеприготовленного на буфере Трис-HCl 25 мМ, pH 8.5. Реакцию проводили в течение 1 часа при 37 °С и останавливали добавлением 10 мкл концентрированного формалина. Колориметрическое измерение проводили с помощью планшетного иммунохимического ридера Dynatech при длине волны 595 нм. Каждое определение выполнялось в трех-пяти повторностях, что позволяло определить стандартное отклонение. Единицу b-галактозидазной активности определяли как количество фермента, вызывающего увеличение поглощения при 595 нм на 1 КОЕ в сутки в после инкубации с субстратом в течение 1-5 часов при 37 °С.

Результаты и их обсуждение

Для изучения активности промоторов генов ENA и KGDH мы разработали репортерную систему на основе β-галактозидазы E. coli. Преимущество репортерной конструкции с геном lacZ заключается в возможности использования общедоступных и высокочувствительных хромофорных субстратов X-gal и о-фенолгалактозид. β-галактозидаза обладает высокой устойчивостью в клетках различных организмов, что позволяет избежать влияния на результаты измерения протеолитической деградации, которая, в свою очередь, проявляет высокую физиологическую вариативность. Использование удобного для измерения репортерного фермента позволяет исследовать значительное число экспериментальных точек в каждой серии, что создает возможность изучать работу промоторов в широком диапазоне значений рН среды, детально характеризовать их чувствительность к изменению количественного и качественного состава среды по таким параметрам, как доступность пептидов, сахаров, солей. Карты полученных конструкций представлены на рис. 1.

Конструкции pQE-KGDH-LacZ, pQE-ENA-LacZ и pQE-hp4d-LacZ использовались для введения в геном модельного штамма Y. lipolytica Po1f, несущего маркер ауксотрофности Ura3. Подобно своим генетическим предшественникам, штамм Po1f обладает высокой способностью к росту при щелочных значениях рН среды. Конструкции не способны к автономной репликации в клетках Y. lipolytica и приобретают способность к стабильному наследованию в них только в результате интеграции в хромосому путем гомологичной рекомбинации. При этом ожидается два варианта геномной локализации - по геномному локусу URA 3 и по локусу, служившему источником исследуемого промотора ENA или KGDH (рис. 2).

В случае локализации конструкции по локусу ENA, возникает такая комбинация генов, в которой ген Na-зависимой АТРазы находится под влиянием клонированного промотора, усеченного на расстоянии 758 п.н. от старта трансляции. При наличии регуляторных сайтов выше указанного адреса в геноме Y. lipolytica, в этом случае профиль регуляции промотора окажется изменен, что может сказаться на синтезе Na-зависимой АТРазы, и поставить под вопрос сам факт выживания дрожжей на щелочных значениях рН внешней среды.

Для изучения значимости этого эффекта конструкции pQE-KGDH-LacZ и pQE-ENA-LacZ в момент введения в геном Y. lipolytica линеаризовались по двум различным сайтам, что стимулировало интеграцию конструкций в различные сайты. В случае сайта PstI, расположенного в гене URA3, ожидалась преимущественная интеграция конструкций в локус URA3, а при линеаризации по сайту EcoRI, расположенного на фланге исследуемых промоторов - в сайты KGDH и ENA1, соответственно. Необходимо отметить, что штаммы, полученные при использовании различных схем интеграции, имели одинаковую жизнеспособность и скорость роста, хотя частота образования колоний трансформантов в случае использования для линеаризации сайта PstI в 10-20 раз превышала аналогичный показатель для плазмид pQE-KGDH-LacZ и pQE-ENA-LacZ, линеаризованных по сайту EcoRI (данные не приведены). В случае конструкций pQE-hp4d-LacZ и pQE-LacZ линеаризацию проводили только по сайту PstI, поскольку в их составе не имелось сайтов, пригодных для интеграции в геном Y. lipolytica помимо URA3. Рекомбинантные клоны на основе штамма PO1f с введенными репортёрными конструкциями отбирали с помощью троекратного пассирования на минимальной среде, не содержащей урацила, после чего переносили на полноценную питательную среду.

1a 

а

1b

б

в

в

Рис. 1. Карты репортёрных интегративных конструкций на основе гена lacZ
для тестирования активности pH-индуцибельных промоторов ENA, KGDH и HP4d в клетках Y. lipolytica

1) по эндогенному промотору Na АТФазы:

2a

2) по фрагменту хромосомного гена URA3:

2b

Рис. 2. Возможные варианты интеграции конструкций в геном Y. lipolytica
в результате гомологичной рекомбинации

Полученные трансформанты (5 независимых клонов для каждого генотипа) высевали на полноценную жидкую среду III (см. «Материалы и методы») для получения инокулята. После этого проводили физиологический эксперимент, как описано в разделе «Материалы и методы». Активность LacZ определяли с использованием хромогенного субстрата X-gal, нормируя ее на содержание общего белка в клеточном лизате, что позволяло получать достоверные результаты вне зависимости от эффективности дезынтеграции клеточной культуры. Каждое измерение проводили в иммунологических планшетах в трех повторностях, определяя стандартную ошибку измерения. рН среды, в которой проводилась ферментативная реакция, указан в заголовках столбцов. Результаты измерений представлены на рис. 3.

3a  3b 

а             б

3в   3г

в    г

3д   3е

д  е

Рис. 3. Уровень активности β-галактозидазы в лизатах рекомбинантных штаммов Y. lipolytica, выращенных на средах различного состава и рН
(в единицах активности на мг общего белка лизата):

Среда I  -  YNB с 1% глицерином;

Среда II  -  YNB с 1% глицерином + 1 M NaCl;

Среда III  -  YNB с 2% глюкозой и 2% протеозным пептоном (Merck);

Среда IV  -  2% глюкозы и 2% пептона без добавления солей;

Среда V  -  YNB, разбавленная в 2 раза, с 2% глюкозы и 2% пептон;

Среда VI  -  2% глюкозы, 1 % дрожжевого экстракта (Panreac) и 2% пептон

На основании проведенных экспериментов сделаны следующие выводы:

1. В экспериментах по определению активности b-галактозидазы по хромогенному субстрату мы использовали 96-луночные иммунологические планшеты, что снизило точность выполнения измерений на уровне оптического сигнала по сравнению с кюветами. Однако благодаря высокой скорости постановки анализа этот метод позволил выполнять большое количество повторностей измерения, в том числе, с использованием нескольких независимо полученных и культивировавшихся изогенных клонов. С учётом высокой величины разброса физиологических характеристик роста культуры по сравнению с погрешностью работы оптических приборов, этот подход представляется нам наиболее адекватным для получения достоверных результатов. При сопоставлении данных по величине репортерного сигнала отрицательного контроля pQE-LacZ (рис. 3а) и положительного контроля pQE-HP4d-LacZ (рис. 3б) можно сделать вывод об отсутствии в предложенной нами репортёрной системе факторов фона, существенно влияющих на выводы из эксперимента. Активность промотора HP4d, как и ожидалось, оказывается максимальной при оптимальных для роста Y. lipolytica условиях среды (III). При росте на средах с недостатком органических или минеральных компонентов (IV, V, VI) или при избытке соли (II) уровень репортерного сигнала оказывается несколько сниженным. Это обстоятельство может быть обусловлено как частичной репрессией промотора HP4d, так и худшими условиями для трансляции, фолдинга и сохранности LacZ в клетке на уровне метаболизма белка. В то же время, необходимо отметить наличие достоверно измеряемого, хотя и низкого по сравнению с положительным контролем, уровня сигнала в штамме, несущем беспромоторную конструкцию pQE-LacZ, особенно, при культивировании на полноценных средах. Активность b-галактозидазы, определенная в осветленных клеточных лизатах после хранения в течение 1 суток, достоверно не отличалась от активности свежеприготовленных лизатов. Это свидетельствует об устойчивости b-галактозидазы в отношении протеолитической деградации со стороны протеаз Y. lipolytica, несмотря на отсутствие в препаратах ингибиторов протеаз. Это наблюдение косвенно свидетельствует о высокой стабильности b-галактозидазы и in vivo в цитоплазме дрожжевых клеток, что имеет существенное значение при проведении экспериментов по изучению активности промоторов в репортёрных системах на основе LacZ в зависимости от стадии роста дрожжевой культуры.

2. При исследовании конструкций на основе промотора ENA1 вне зависимости от сайта интеграции в геном Y. lipolytica (рис. 3в и 3г) можно сделать вывод о том, что индукция синтеза Na-зависимой АТФазы в клетках Y. lipolytica в ответ на защелачивание среды культивирования происходит лишь при росте на синтетической среде с глицерином и сукцинатом в качестве источников энергии и углерода, но не на полноценных средах с глюкозой и пептоном (среды III-VI). Этот вывод противоречит мнению авторов работ [2, 5-8], предположивших, что повышение активности Na-зависимой АТФазы является универсальной молекулярной основой адаптации Y. lipolytica к щелочным условиям среды, отличающим ее от других видов дрожжей-аскомицетов. Более того, при росте на среде с высоким содержанием NaCl (среда II) активность промотора ENA1 супрессируется, а не активируется повышением рН. В совокупности эти наблюдения позволяют предположить, что гипотеза о функциональной замене в условиях роста Y. lipolytica на щелочных средах протон-зависимого симпорта метаболитов на Na-зависимый [2, 6] описывает поведение дрожжей лишь на средах с определенным составом питатальных компонентов. Таким образом, она не может рассматриваться в качестве основного механизма уникальной способности Y. lipolytica к росту в условиях щелочного стресса.

3. С использованием конструкции pQE-KGDH-LacZ (рис. 3е) впервые показана высокая pH-индуцибельность промотора гена a-кетоглутаратдегидрогеназы Y. lipolytica. Показано, что при культивировании дрожжей на богатых средах этот промотор в 1,5 раза превосходит по силе и в 10-15 раз по коэффициенту рН-зависимой индукции наиболее эффективный из известных на сегодня промоторов HP4d. В отличие от промотора ENA, промотор KGDH подвергается транскрипционной активации на средах с высоким рН вне зависимости от состава питательных компонентов. Таким образом, можно предположить, что изменение состава ферментов и других белков в матриксе митохондрий (примером которых является a-кетоглутаратдегидрогеназа) служит одним из центральных пунктов регуляции клеточного метаболизма Y. lipolytica, позволяющего этому виду успешно расти при щелочных условиях среды в отличие от других видов дрожжей-аскомицетов.

4. При сопоставлении транскрипционной активности конструкции pQE-KGDH-LacZ, интегрированной в геном Y. lipolytica по локусу URA3 (рис. 3д) и по локусу KGDH (рис. 3е), можно сделать вывод о том, что эффективность и рН-индуцибельность промотора a-кетоглутаратдегидрогеназы зависит от его локализации в геноме. В первом случае активность промотора при росте на щелочных средах оказывается низкой по сравнению со вторым. При росте на кислых средах, напротив, конструкция pQE-KGDH-LacZ, интегрированная в локус URA3, транскрибируется активнее, чем та же конструкция, интегрированная в локус KGDH - уровень транскрипционной репрессии в непермиссивных условиях оказывается низким. Особенно ярко низкая рН-индуцибельность конструкции pQE-KGDH-LacZ, интегрированной в локус URA3, проявляется на полноценных питательных средах (III-VI). При культивировании на синтетических средах с сукцинатом и глицерином в качестве источника энергии (I и II) конструкция, pQE-KGDH-LacZ, интегрированная в локус URA3, все же проявляет высокую рН-индуцибельность. В сумме, это позволяет предположить существование в клетке двух уровней регуляции промотора KGDH, которые можно условно обозначить как «ближний» и «дальний». Ближний уровень регуляции, вероятно, связан с активностью известных транскрипционных факторов ответа на щелочной стресс -
Rim101, Nrg, Mig, кальциневрина и других. Он проявляется при щелочной индукции промотора KGDH, интегрированного в локус URA3, при росте дрожжей на минимальных средах I и II, но подавляется верхним уровнем регуляции при росте той же культуры на полноценных средах III-VI. При интеграции конструкции pQE-KGDH-LacZ в геномный локус KGDH наряду с ближним задействуется активирующая составляющая дальнего уровня регуляции, связанного с активностью дистальных по отношению к регулируемому гену хромосомных элементов. Этот уровень, по-видимому, является ответственным за подавление активности промотора KGDH, находящегося в собственном геномном локусе, при росте на кислых средах вне зависимости от их состава. В случае переноса в щелочные условия он синергично с ближним уровнем обеспечивает мощную индукцию промотора, в результате чего активность промотора KGDH, интегрированного в локус KGDH, превышает уровень активности такого мощного синтетического промотора, как HP4d.

Список литературы

  1. Гусева М.А.. Изучение механизмов адаптации дрожжей Yarrowia lipolytica к росту при щелочных условиях методами протеомики / М.А. Гусева, Е.Ю. Эпова, Л.И. Ковалев, А.Б. Шевелев // Прикл. биох. микробиол. - 2010. - Т. 46, №3. - C. 336-341.
  2. Alepuz P.M., Cunningham K.W., Estruch F. Glucose repression affects ion homeostasis in yeast through the regulation of the stress-activated ENA1 gene / P.M. Alepuz, K.W. Cunningham, F. Estruch // Mol. Microbiol. - 1997. - Vol. 26, №.1. - P. 91-98.
  3. Madzak C. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review / C. Madzak, C. Gaillardin, J.M. Beckerich // J. Biotechnol. - 2004. - Vol. 109, №. 1-2. - P. 63-81.
  4. Madzak C. Strong hybrid promoters and integrative expression/secretion vectors for quasi-constitutive expression of heterologous proteins in the yeast Yarrowia lipolytica / C. Madzak, B. Tréton, S. Blanchin Roland // J. Mol. Microbiol. Biotechnol. - 2000. - Vol. 2, № 2. - P. 207-216.
  5. Mendizabal I. Promoter sequences regulated by the calcineurin-activated transcription factor Crz1 in the yeast ENA1 gene / I. Mendizabal, A. Pascual-Ahuir, R. Serrano, I.F. de Larrinoa // Mol. Genet. Genomics. - 2001. - Vol. 265. - P. 801-811.
  6. Mendoza I. Activated Calcineurin Confers High Tolerance to Ion Stress and Alters the Budding Pattern and Cell Morphology of Yeast Cells / I. Mendoza, F.J. Quintero, R.A. Bressan, P.M. Hasegawa, J.M. Pardo // J. Biol. Chem. - 1996. - Vol. 271. - P. 23061-23067.
  7. Posas F. The PPZ Protein Phosphatases Are Important Determinants of Salt Tolerance in Yeast Cells / F. Posas, M. Camps, and J. Arino // J. Biol. Chem. - 1995. - Vol. 270. - P. 13036-13041.
  8. Proft M. Repressors and Upstream Repressing Sequences of the Stress-Regulated ENA1 Gene in Saccharomyces cerevisiae: bZIP Protein Sko1p Confers HOG-Dependent Osmotic Regulation / M. Proft, R. Serrano // Mol. Cell. Biol. - 1999. - Vol. 19, № 1. - P. 537-546.

Рецензенты:

Ляпустин Виктор Николаевич, д.б.н., с.н.с., в.н.с. лаборатории молекулярной биологии, ИПВЭ им.М.П. Чумакова РАМН;

Фаизов Тагир Хадиевич, д.б.н., зав. лабораторией молекулярно - генетического анализа ФГУ «Федеральный центр токсикологической и радиологической безопасности животных» Казань.