Научный журнал
Фундаментальные исследования
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,749

ИССЛЕДОВАНИЕ ПОЛИМОРФИЗМА ГЕНА МОЗГОВОГО НЕЙРОТРОФИЧЕСКОГО ФАКТОРА У ЛИЦ С ДЕПРЕССИВНЫМИ И КОМОРБИДНЫМИ СЕРДЕЧНО-СОСУДИСТЫМИ ЗАБОЛЕВАНИЯМИ

Шмиголь М.В. 2 Левчук Л.А. 2 Лебедева Е.В. 2 Симуткин Г.Г. 2 Сергиенко Т.Н. 1 Иванова С.А. 2
1 ФГБУ «Научно-исследовательский институт кардиологии» Сибирского отделения Российской академии медицинских наук, Томск
2 ФГБУ «Научно-исследовательский институт психического здоровья» Сибирского отделения Российской Академии медицинских наук, Томск
Проведено исследование распределения генотипов полиморфного варианта Val66Met гена мозгового нейротрофического фактора (BDNF) в группах лиц с депрессивными расстройствами в рамках F31-F34 (МКБ-10), больных, страдающих депрессивными и коморбидными сердечно-сосудистыми заболеваниями, и психически и соматически здоровых людей. Статистический анализ полученных результатов выявил тенденцию к снижению частоты встречаемости гомозиготного генотипа Met/Met и минорного аллеля Met гена нейротрофического фактора мозга BDNF среди пациентов с депрессивными расстройствами по сравнению с группой психически и соматически здоровых людей. Наши данные согласуются с результатами исследований, проведенных в последние годы, и подтверждают участие нейротрофической системы в патогенезе аффективных расстройств, однако, вероятно, полиморфизм локуса гена BDNF влияет на поведение человека и развитие депрессивных расстройств через другие механизмы и системы, в том числе с участием серотонинергической системы.
полиморфизм
BDNF
депрессивные расстройства
сердечно-сосудистые заболевания
1. Гусев Е.И. Ишемия головного мозга / Е.И. Гусев, В.И. Скворцова – М.: Медицина, 2001. – C. 326.
2. Изнак А.Ф. Роль нейрональной пластичности в патогенезе и терапии аффективных расстройств: энциклопедия депрессий // Человек и лекарство: XII Российский национальный конгресс. – М., 2005. – C. 2–4.
3. Исследование связи полиморфных маркеров генов мозгового нейротрофического фактора и рецептора серотонина типа 2а с показателями произвольного и непроизвольного зрительного внимания при шизофрении / М.В. Алфимова, Т.В. Лежейко, В.Е. Голимбет, Г.И. Коровайцева,
О.М. Лаврушина, Н.Ю. Колесина, Л.П. Фролова, А.А. Муратова, Л.И. Абрамова, В.Г. Каледа // Журнал неврологии и психиатрии им. С.С. Корсакова. – 2008. – №4. – С. 62–69.
4. Краснов В.Н. Расстройства аффективного спектра. – М.: Практическая медицина, 2011. – 432 с.
5. Морозов П.В. Суицидальность при депрессии: влияние генетических факторов и антидепрессантов // Психиатрия и психофармакология. – 2010 – №1. – С. 4–7.
6. Изучение полиморфных вариантов гена рецептора серотонина типа 2А 5-HTR2A при пограничных психических расстройствах / Л.А. Рядовая, Е.В. Гуткевич, О.М. Лаврушина, С.А. Иванова, В.Я. Семке // Сибирский вестник психиатрии и наркологии. – 2007. – №4 (47) – С. 12–15.
7. Смулевич А.Б. Психосоматическая медицина // Психосоматические расстройства в общей медицине. – 2007. – №1. – С. 4–10.
8. Anguelova M. A systematic review of association studies investigating genes coding for serotonin receptors and the serotonin transporter / M. Anguelova, C. Benkelfat, G. Turecki // Mol Psychiat. – 2003. – Vol. 8 – P. 646–653.
9. Brain-derived neurotrophic factor-5-HTTLPR gene interactions and environmental modifiers of depression in children / Joan Kaufman, Bao-Zhu Yang, Heather Douglas-Palumberi, Damion Grasso, Deborah Lipschitz, Shadi Houshyar, John H. Krystal, and Joel Gelernter // Biol. Psychiatry. – 2006. – Vol. 59. – P. 673–680.
10. Kocabas N.A. Brain-derived neurotrophic factor gene polymorphisms: influence on treatment response phenotypes of major depressive disorder / N.A. Kocabas, I. Antonijevic,
C. Faghel, C. Forray, S. Kasper, Y. Lecrubier, S. Linotte, I. Massat, J. Mendlewicz, M. Noro, S. Montgomery, P. Oswald, L. Snyder, J. Zohar, D. Souery // Int. Clin. Psychopharmacol. – 2011. – Vol. 26, №1. – P. 1–10.
11. Evidence of biologic epistasis between BDNF and SLC6A4 and implications for depression / Pezawas L., Meyer-Lindenberg A., Goldman A.L., Verchinski B.A., Chen G., Kolachana B.S. // Mol Psychiatry. – 2008. – Vol. 13 – P. 709–716.
12. Savitz J. The molecular genetics of cognition: dopamine, COMT and BDNF / J. Savitz, M. Solms, R. Ramesar // Genes Brain Behavior – 2006. – Vol. 5. – P. 311–328.
13. Verhagen M. Meta-analysis of the BDNF Val66Met polymorphism in major depressive disorder: effects of gender and ethnicity / Verhagen M. van der Meij A., van Deurzen P.A., Janzing J.G., Arias-Vasquez A., Buitelaar J.K. // Mol Psychia-
try – 2010. – Vol. 15 – P. 260–71.
14. Yoshimura R. The brain-derived neurotrophic factor (BDNF) polymorphism Val66Met is associated with neither serum BDNF level nor response to selective serotonin reuptake inhibitors in depressed Japanese patients / R. Yoshimura,
T. Kishi, A. Suzuki // Prog. Neuropsychopharmacol. Biol. Psychiatry. – 2011. – Vol. 35, №4. – P. 1022–1025.
15. Yu H. The role of BDNF in depression on the basis of its location in the neural circuitry / H. Yu, Z.Y. Chen // Acta Pharmacol. Sin. – 2011. – Vol. 32, №1. – P. 3–11.

В современной эпидемиологической ситуации депрессивные расстройства привлекают особое внимание, как клинический и социальный феномен и как объект терапевтических поисков в связи с широкой распространённостью этих расстройств, их социальной значимостью, влиянием на трудоспособность, высокой степенью их коморбидности с сердечно-сосудистыми заболеваниями [4]. Увеличение числа аффективных, в частности, депрессивных состояний связано с рядом факторов: ростом числа аффективных расстройств, патоморфозом психических заболеваний, все чаще приобретающих приступообразное течение, что как правило, сопровождается развитием аффективных расстройств [7]. Причины и механизм развития аффективных расстройств в настоящее время полностью не раскрыты, однако, в последнее время появились существенные новые данные, в первую очередь о факторах, детерминирующих предрасположенность к развитию депрессии и нейрохимии аффективной патологии, а также действия антидепрессантов на уровне рецепторов нервных клеток.

В настоящее время активно изучается нейротрофическая теория развития депрессии, она наиболее полно объясняет возникающие при депрессивных расстройствах морфологические изменения в головном мозге [14, 15]. Мозговой нейротрофический фактор (BDNF) и серотонинергическая система, взаимодействуя друг с другом в ЦНС и совместно модулируя мозговые процессы, участвуют в патогенезе тревоги, депрессии и нарушений когнитивных процессов у человека [9]. Нейротрофические факторы играют важную роль при развитии любого, в том числе ишемического, поражения нервной ткани, они определяют соотношение процессов гибели нервных клеток и репаративных процессов. Любое повреждение ткани мозга приводит к активации механизмов нейропластичности, представляющей собой ответ на патологическое воздействие сохранившихся нейронов и компенсаторно-восстановительные механизмы. Проведенные исследования показали, что депрессия приводит к нарушениям нейропластичности, что, возможно, служит основой для хронизации процесса и развития когнитивного дефицита [1].

Деструктивные процессы, отмечающиеся на фоне аффективных расстройств, являются частично обратимыми при терапии нейротрофическими и нейропротективными препаратами [2]. Терапия антидепрессантами увеличивает выработку BDNF, что приводит к восстановлению процессов нейрогенеза и нейрональной пластичности. В последние годы широко исследуется возможность использования показателя концентрации BDNF в сыворотке крови и/или полиморфизмов гена BDNF для прогноза или оценки эффективности ответа на терапию [10], в то же время существуют работы, свидетельствующие об отсутствии корреляции с отвечаемостью на фармакотерапию антидепрессантами [14].

Целью настоящей работы явилось изучение полиморфизма гена мозгового нейротрофического фактора (BDNF) у лиц с депрессивной симптоматикой и психически здоровых людей.

Материалы и методы исследования

Исследование молекулярно-биологических признаков было проведено в группе 285 человек, которые, исходя из анамнеза, были поделены на следующие группы:

1 - первая группа включила пациентов с депрессивными расстройствами в рамках F31-F33 (МКБ-10), средний возраст которых составил 53 ± 9,8 лет. Пациенты с депрессивной симптоматикой проходили курс лечения в отделении аффективных состояний клиник НИИПЗ СО РАМН.

2 - вторая выборка включила больных, страдающих депрессивными и коморбидными сердечно-сосудистыми заболеваниями, средний возраст этих пациентов составил 56 ± 7,5 лет. Пациенты этой группы проходили курс лечения в ФБГУ «НИИ кардиологии» СО РАМН.

3 - в третью группу вошли психически и соматически здоровые люди, соответствующие по полу и возрасту обследуемым группам больных, не имеющие хронических заболеваний и не стоящие на диспансерном учете, без признаков перенесенных острых инфекционных заболеваний на момент обследования.

Кровь для биологических исследований у пациентов и психически здоровых лиц забирали из локтевой вены, утром, натощак. Группа исследуемых сформирована из этнически русских лиц и не состоящих в кровном родстве.

Генетические исследования проводились согласно этическим принципам медицинской генетики, в соответствии с Хельсинской декларацией Всемирной ассоциации «Этические принципы проведения научных медицинских исследований с участием человека» с поправками 2000 г. и правилами клинической практики в РФ, утвержденными Приказом Минздрава РФ от 19.06.2003 г. № 266. Исследование проводилось на базе лаборатории клеточных и молекулярно-биологических исследований НИИПЗ СО РАМН (руководитель лаборатории - д-р мед. наук, профессор С.А. Иванова).

Для генотипирования использовали набор реагентов TaqMan® SNP Genotyping Assay фирмы Applied Biosystems (США). Определение аллельных вариантов гена BDNF rs 6265 проводили методом полимеразно-цепной реакции (ПЦР) в реальном времени со специфическими праймерами, результаты реакции детектировали с помощью флуоресцентных Taq-man зондов, комплиментарных полиморфному участку ДНК TCCTCATCCAACAGCTCTTCTATCA[C/T]GTGTTCGAAAGTGTCAGCCAATGAT.

Амплификацию ДНК проводили в объеме реакционной смеси, равной 20 мкл и содержащей 2,5 мкл ДНК матрицы и 17,5 мкл реакционной смеси набора в следующем режиме: первичный прогрев и регистрация флуоресцентных сигналов - 30 с при 60°С; начальная денатурация - 10 мин при 95°С; затем 40 циклов: денатурация - 15 с при 95°С; отжиг - 15 с при 60°С для пар праймеров BDNF rs 6265; элонга- ция - 30 с при 60°С; регистрация флуоресцентных сигналов - 15 с при 60°С; после чего конечная элонгация и регистрация флуоресцентных сигналов в конечной точке - 30 с при 60°С. Для проведения полимеразно-цепной реакции использовали Real-Time ДНК амплификатор «StepOnePlus» фирмы Applied Biosystems (США). Статистическая обработка результатов проводилась с использованием пакета программ SPSS для Windows, версия 15.0. Для проверки соответствия распределения частот генотипов исследуемого гена равновесному распределению Харди-Вейнберга использовался модифицированный критерий χ². Сравнение частот генотипов и аллелей анализируемых групп проводили с помощью критериев χ2, Фишера. Различия считали достоверными при р < 0,05.

Результаты исследования и их обсуждение

Результаты исследования гена нейротрофического фактора мозга BDNF представлены в табл. 1. Как видно из таблицы, распределение частот генотипов в исследованных группах соответствует распределению Харди-Вайнберга. В обследованных группах наиболее частым генотипом был Val/Val, в группе лиц с депрессией частота этого генотипа составила 67%, во второй группе у лиц с депрессией и соматическим заболеванием - 75,3%, в группе контроля - 67,1% соответственно. Вторым по частоте встречаемости был гетерозиготный генотип Val/Met (33; 23,5 и 30,6% соответственно). Наиболее редким был гомозиготный генотип Met/Met. В группе пациентов с депрессивными расстройствами этот генотип не обнаружен, в выборке больных депрессивными и коморбидными сердечно-сосудистыми заболеваниями генотип Met/Met составил 1,2%, в группе психически и соматически здоровых людей - 2,3%. По частоте встречаемости аллелей во всех исследуемых группах преобладал аллель Val, так в группе лиц с депрессивными расстройствами частота этого аллеля составила 83,6%, в группе больных депрессивными и коморбидными сердечно-сосудистыми заболевания- ми - 87%, в выборке здоровых людей - 82,5%. Минорный аллель Met в группе пациентов с депрессивными расстройствами составил 16,4%, среди больных депрессией и соматическими заболеваниями - 13%, в группе психически здоровых лиц этот аллель составил 17,5%.

Таблица 1

Распределение частот генотипов гена мозгового нейротрофического фактора (BDNF) и соответствие распределению Харди - Вайнберга (χ2) в исследуемых группах

Исследуемые группы

N

Генотипы

Аллели

Val/Val, %

Val/Met, %

Met/Met, %

Val, %

Met, %

Пациенты с депрессивными расстройствами

70

47 (67)

23 (33)

0

117 (83,6)

23 (16,4)

χ2 = 1,276; P = 0,259

Пациенты с депрессивными и сердечно-сосудистыми заболеваниями

81

61 (75,3)

19 (23,5)

1 (1,2)

141 (87)

21 (13)

χ2 = 0,006; P = 0,939

Психически и соматически здоровые лица

134

90 (67,1)

41 (30,6)

3 (2,3)

221 (82,5)

47 (17,5)

χ2 = 0,44; Р = 0,502

Примечание: N - число обследованных, в скобках - частота встречаемости,%.

Сравнительный анализ распределения частот генотипов полиморфного маркера исследуемого гена BDNF (рис. 1) не выявил статистических различий в частотах генотипов между двумя группами больных депрессивными расстройствами (χ2 = 2,407; Р = 0,3). Не было выявлено статистических различий распределения генотипов между группой пациентов с депрессивными расстройствами и контролем (χ2 = 1,642; Р = 0,44). При статистическом анализе частот генотипов среди группы контроля и выборки кардиологических больных с депрессивной симптоматикой не было выявлено значимых различий (χ2 = 1,673; Р = 0,433).

Рис. 1. Сравнительный анализ распределения частот генотипов мозгового нейротрофического фактора (BDNF) в исследуемых группах

Оценка распределения частот аллелей гена BDNF между исследуемыми выборками (рис. 2) также не выявила различий в частоте встречаемости полиморфизма Val66Met гена BDNF (между двумя группами больных депрессивными расстройствами χ2 = 0,473; Р = 0,492; между группой пациентов с депрессивными расстройствами и группой контроля χ2 = 0,021; Р = 0,88; между группой здоровых людей и кардиологическими пациентами с депрессивной симптоматикой χ2 = 1,262; Р = 0,28).

Рис. 2. Сравнительный анализ распределения частот аллелей мозгового нейротрофического фактора (BDNF) в исследуемых группах

Таким образом, при исследовании полиморфизма Val66Met гена BDNF выявлена тенденция к снижению частоты встречаемости гомозиготного генотипа Met/Met и аллеля Met среди пациентов с депрессивными расстройствами по сравнению с психически здоровыми людьми. По литературным данным известно, что гетерозиготы и гомозиготы по аллелю Met составляют 30-50% различных популяций, причем гомозиготы встречаются редко и в европейской популяции составляют всего 4%. Важно также отметить, что наличие генотипа Met/Met и минорного аллеля Met связано со снижением синаптической активности и пластичности в гиппокампе, что приводит к снижению секреции BDNF, предположительно приводящей к формированию депрессии [3]. В нашем исследовании все гомозиготы по аллелю Met, как среди здоровых лиц, так и среди пациентов, мужчины. В работе M. Verhagen et al. [13] указано, что генотип Met/Met может быть ассоциирован с мужским полом. На уровне морфологии мозга у носителей аллеля Met обнаружено уменьшение объемов дорсолатеральной префронтальной коры и гиппокампа [12]. В исследовании Pezawas L. [11] было отмечено, что у носителей аллеля Met менее выражены предрасположенность к депрессии, агрессивности, суицидальному поведению, однако, эти качества ассоциированы с генами серотониновой системы [8]. В проведенных нами ранее исследованиях [6] показана ассоциация локуса Т102С гена рецептора серотонина типа 2А 5-HTR2A с расстройствами адаптации с преобладанием депрессивных реакций. Однако существуют данные, свидетельствующие об ассоциации аллеля Val полиморфизма Val66Met с тревогой и депрессией [11]. Генотипирование по исследуемому локусу показало, что частота аллеля Val выше в группе пациентов с депрессивными и коморбидными сердечно-сосудистыми заболеваниями, чем частота этого аллеля у больных депрессивными расстройствами и психически здоровых лиц (87, 83,6 и 82,5% соответственно), что, вероятно, подтверждает данные об утяжелении течения и ухудшении прогноза депрессивных расстройств при наличии сопутствующей сердечно-сосудистой патологии [7]. Можно предположить, что нарушения в нейротрофической системе, вызванные генетическими мутациями, приводят к ухудшению нейропластичности и повреждению мозговых структур, связанных как с патофизиологией депрессии (гиппокамп), так и с произвольным контролем поведения (префронтальная кора) [5].

Заключение

В результате нашего исследования выявлена тенденция к снижению частоты встречаемости аллеля Met и гомозиготного генотипа Met/Met гена нейротрофического фактора мозга BDNF среди пациентов с депрессивными расстройствами по сравнению с группой психически и соматически здоровых людей. Наши данные согласуются с результатами исследований, проведенных в последние годы, и подтверждают участие нейротрофической системы в патогенезе аффективных расстройств, однако, вероятно, полиморфизм локуса гена BDNF влияет на поведение человека и развитие депрессивных расстройств через другие механизмы и системы, в том числе с участием серотонинергической системы.

Рецензенты:

  • Балашов П.П., д.м.н., профессор, зав. кафедрой психиатрии, наркологии, психотерапии, Гоу впо «Сибирский государственный медицинский университет» Министерства здравоохранения и социального развития Российской Федерации, г. Томск;
  • Куликова Н.В., д.м.н., профессор кафедры безопасности жизнедеятельности ФГБОУ ВПО «Томский государственный педагогический университет Министерства образования и науки РФ», г. Томск.

Работа поступила в редакцию 20.04.2012


Библиографическая ссылка

Шмиголь М.В., Левчук Л.А., Лебедева Е.В., Симуткин Г.Г., Сергиенко Т.Н., Иванова С.А. ИССЛЕДОВАНИЕ ПОЛИМОРФИЗМА ГЕНА МОЗГОВОГО НЕЙРОТРОФИЧЕСКОГО ФАКТОРА У ЛИЦ С ДЕПРЕССИВНЫМИ И КОМОРБИДНЫМИ СЕРДЕЧНО-СОСУДИСТЫМИ ЗАБОЛЕВАНИЯМИ // Фундаментальные исследования. – 2012. – № 5-2. – С. 388-392;
URL: https://fundamental-research.ru/ru/article/view?id=29942 (дата обращения: 02.12.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074