Scientific journal
Fundamental research
ISSN 1812-7339
"Перечень" ВАК
ИФ РИНЦ = 1,222

STUDY OF POLYMORPHISM GENE BRAIN-DERIVED NEUROTROPHIC FACTOR IN PATIENTS WITH DEPRESSIVE DISORDERS AND CARDIOVASCULAR DISEASES

Shmigol M.V. 2 Levchuk L.A. 2 Lebedeva E.V. 2 Simutkin G.G 2 Sergienko T.N. 1 Ivanova S.A. 2
1 Institute of Cardiology, Siberian Branch of the Russian Academy of Medical Sciences, Tomsk
2 Mental Health Research Institute SB RAMSci, Tomsk
Проведено исследование распределения генотипов полиморфного варианта Val66Met гена мозгового нейротрофического фактора (BDNF) в группах лиц с депрессивными расстройствами в рамках F31-F34 (МКБ-10), больных, страдающих депрессивными и коморбидными сердечно-сосудистыми заболеваниями, и психически и соматически здоровых людей. Статистический анализ полученных результатов выявил тенденцию к снижению частоты встречаемости гомозиготного генотипа Met/Met и минорного аллеля Met гена нейротрофического фактора мозга BDNF среди пациентов с депрессивными расстройствами по сравнению с группой психически и соматически здоровых людей. Наши данные согласуются с результатами исследований, проведенных в последние годы, и подтверждают участие нейротрофической системы в патогенезе аффективных расстройств, однако, вероятно, полиморфизм локуса гена BDNF влияет на поведение человека и развитие депрессивных расстройств через другие механизмы и системы, в том числе с участием серотонинергической системы.
The study of genotypes distribution of the polymorphic variants Val66Met brain-derived neurotrophic factor (BDNF) gene in the groups of people with depressive disorders in the F31-F34 (ICD-10), patients with depressive and comorbid cardiovascular disease, and mentally and physically healthy people. Statistical analysis of the results revealed a tendency to decrease the incidence of homozygous genotype Met/Met and Met minor allele of the gene of brain-derived neurotrophic factor BDNF in patients with depressive disorders, compared with a group of mentally and somatically healthy people. Our data are consistent with the results of studies conducted in recent years, and confirm the participation of neurotrophic system in the pathogenesis of mood disorders, however, likely locus polymorphism of the BDNF gene affects human behavior and development of depressive disorders through other mechanisms and systems, including those involving the serotonergic system.
polymorphism
BDNF
depression
cardiovascular diseases
1. Gusev E.I. Ishemijagolovnog mozga (Сerebral ischemia). Moscow: Medicina, 2001. 326 p.
2. Iznak A.F. Rol’ nejronal’noj plastichnosti v patogeneze i terapii affektivnyh rasstrojstv: jenciklopedija depressij HII Rossijskijnacional’nyjkongress «Chelovek i lekarstvo» (The role of neuronal plasticity in the pathogenesis and treatment of affective disorders:Encyclopedia of Depression XII Russian National Congress «Man and Drugs»). Moscow, 2005, pp. 2–4.
3. M.V. Alfimova, T.V. Lezhejko, V.E. Golimbet, G.I. Korovajceva, O.M. Lavrushina, N.Ju. Kolesina, L.P. Frolova, A.A. Muratova, L.I. Abramova, V. G. Kaleda. Zhurnal nevrologii i psihiatriiim. S.S. Korsakova, 2008, no.4, pp. 62–69.
4. Krasnov V.N. Rasstrojstvaaffektivnogospectra (Affective disorder spectrum) Moscow: Prakticheskaja medicina, 2011, 432 p.
5. Morozov P.V. Psihiatrija i psihofarmakologija- Psychiatry and Psychopharmacology, 2010 , no.1, pp. 4–7.
6. Ryadovaya L.A., Gutkevich E.V., Lavrushina O.M., Ivanova S.A., Semke V.Ya. Sibirskij vestnik psihiatrii i narkologii- Siberian gerald of psychiatry and addiction psychiatry, 2007, no.4 (47), pp. 12–15.
7. Smulevich A.B. Psihosomaticheskie rasstrojstva v obwej medicine- Psychosomatic disorders in general medicine, 2007, no. 1, pp. 4–10.
8. Anguelova M. A Benkelfat C., Turecki G. Systematic review of association studies investigating genes coding for serotonin receptors and the serotonin transporter – Mol. Psychiat., 2003, no.8 pp. 646–653.
9. Kaufman J., Yang B.-Z., Douglas -Palumberi H. et al. Brain-derived neurotrophic factor-5-HTTLPR gene interactions and environmental modifiers of depression in children .Biol. Psychiatry, 2006. –no. 59, pp. 673–680.
10. Kocabas N.A., Antonijevic I., Faghel C. et al. Brain- derived neurotrophic factor gene polymorphisms: influence on treatment response phenotypes of major depressive disorder. Int. Clin. Psychopharmacol, 2011, no. 26 (1), pp. 1–10.
11. Pezawas L., Meyer-Lindenberg A., Pezawas L. et al. Evidence of biologic epistasis between BDNF and SLC6A4 and implications for depression. Mol Psychiatry, 2008, no.13, pp. 709–716.
12. Savitz, J., Solms, M., Ramesar, R. The molecular genetics of cognition: dopamine, COMT and BDNF .Genes Brain Behavior , 2006, no. 5, pp. 311–328.
13. Verhagen M., van der Meij A., van Deurzen P.A. et al. Meta-analysis of the BDNF Val66Met polymorphism in major depressive disorder: effects of gender and ethnicity. Mol Psychiatry, 2010., no. 15, pp. 260–71.
14. Yoshimura, R., Kishi, T., Suzuki, A. The brain-derived neurotrophic factor (BDNF) polymorphism Val66Met is associated with neither serum BDNF level nor response to selective serotonin reuptake inhibitors in depressed Japanese patients . Prog. Neuropsychopharmacol. Biol. Psychiatry, 2011, no.35(4), pp. 1022–1025.
15. Yu, H., Chen, Z. Y. The role of BDNF in depression on the basis of its location in the neural circuitry. Acta Pharmacol. Sin, 2011, no.32 (1), pp. 3–11.

В современной эпидемиологической ситуации депрессивные расстройства привлекают особое внимание, как клинический и социальный феномен и как объект терапевтических поисков в связи с широкой распространённостью этих расстройств, их социальной значимостью, влиянием на трудоспособность, высокой степенью их коморбидности с сердечно-сосудистыми заболеваниями [4]. Увеличение числа аффективных, в частности, депрессивных состояний связано с рядом факторов: ростом числа аффективных расстройств, патоморфозом психических заболеваний, все чаще приобретающих приступообразное течение, что как правило, сопровождается развитием аффективных расстройств [7]. Причины и механизм развития аффективных расстройств в настоящее время полностью не раскрыты, однако, в последнее время появились существенные новые данные, в первую очередь о факторах, детерминирующих предрасположенность к развитию депрессии и нейрохимии аффективной патологии, а также действия антидепрессантов на уровне рецепторов нервных клеток.

В настоящее время активно изучается нейротрофическая теория развития депрессии, она наиболее полно объясняет возникающие при депрессивных расстройствах морфологические изменения в головном мозге [14, 15]. Мозговой нейротрофический фактор (BDNF) и серотонинергическая система, взаимодействуя друг с другом в ЦНС и совместно модулируя мозговые процессы, участвуют в патогенезе тревоги, депрессии и нарушений когнитивных процессов у человека [9]. Нейротрофические факторы играют важную роль при развитии любого, в том числе ишемического, поражения нервной ткани, они определяют соотношение процессов гибели нервных клеток и репаративных процессов. Любое повреждение ткани мозга приводит к активации механизмов нейропластичности, представляющей собой ответ на патологическое воздействие сохранившихся нейронов и компенсаторно-восстановительные механизмы. Проведенные исследования показали, что депрессия приводит к нарушениям нейропластичности, что, возможно, служит основой для хронизации процесса и развития когнитивного дефицита [1].

Деструктивные процессы, отмечающиеся на фоне аффективных расстройств, являются частично обратимыми при терапии нейротрофическими и нейропротективными препаратами [2]. Терапия антидепрессантами увеличивает выработку BDNF, что приводит к восстановлению процессов нейрогенеза и нейрональной пластичности. В последние годы широко исследуется возможность использования показателя концентрации BDNF в сыворотке крови и/или полиморфизмов гена BDNF для прогноза или оценки эффективности ответа на терапию [10], в то же время существуют работы, свидетельствующие об отсутствии корреляции с отвечаемостью на фармакотерапию антидепрессантами [14].

Целью настоящей работы явилось изучение полиморфизма гена мозгового нейротрофического фактора (BDNF) у лиц с депрессивной симптоматикой и психически здоровых людей.

Материалы и методы исследования

Исследование молекулярно-биологических признаков было проведено в группе 285 человек, которые, исходя из анамнеза, были поделены на следующие группы:

1 - первая группа включила пациентов с депрессивными расстройствами в рамках F31-F33 (МКБ-10), средний возраст которых составил 53 ± 9,8 лет. Пациенты с депрессивной симптоматикой проходили курс лечения в отделении аффективных состояний клиник НИИПЗ СО РАМН.

2 - вторая выборка включила больных, страдающих депрессивными и коморбидными сердечно-сосудистыми заболеваниями, средний возраст этих пациентов составил 56 ± 7,5 лет. Пациенты этой группы проходили курс лечения в ФБГУ «НИИ кардиологии» СО РАМН.

3 - в третью группу вошли психически и соматически здоровые люди, соответствующие по полу и возрасту обследуемым группам больных, не имеющие хронических заболеваний и не стоящие на диспансерном учете, без признаков перенесенных острых инфекционных заболеваний на момент обследования.

Кровь для биологических исследований у пациентов и психически здоровых лиц забирали из локтевой вены, утром, натощак. Группа исследуемых сформирована из этнически русских лиц и не состоящих в кровном родстве.

Генетические исследования проводились согласно этическим принципам медицинской генетики, в соответствии с Хельсинской декларацией Всемирной ассоциации «Этические принципы проведения научных медицинских исследований с участием человека» с поправками 2000 г. и правилами клинической практики в РФ, утвержденными Приказом Минздрава РФ от 19.06.2003 г. № 266. Исследование проводилось на базе лаборатории клеточных и молекулярно-биологических исследований НИИПЗ СО РАМН (руководитель лаборатории - д-р мед. наук, профессор С.А. Иванова).

Для генотипирования использовали набор реагентов TaqMan® SNP Genotyping Assay фирмы Applied Biosystems (США). Определение аллельных вариантов гена BDNF rs 6265 проводили методом полимеразно-цепной реакции (ПЦР) в реальном времени со специфическими праймерами, результаты реакции детектировали с помощью флуоресцентных Taq-man зондов, комплиментарных полиморфному участку ДНК TCCTCATCCAACAGCTCTTCTATCA[C/T]GTGTTCGAAAGTGTCAGCCAATGAT.

Амплификацию ДНК проводили в объеме реакционной смеси, равной 20 мкл и содержащей 2,5 мкл ДНК матрицы и 17,5 мкл реакционной смеси набора в следующем режиме: первичный прогрев и регистрация флуоресцентных сигналов - 30 с при 60°С; начальная денатурация - 10 мин при 95°С; затем 40 циклов: денатурация - 15 с при 95°С; отжиг - 15 с при 60°С для пар праймеров BDNF rs 6265; элонга- ция - 30 с при 60°С; регистрация флуоресцентных сигналов - 15 с при 60°С; после чего конечная элонгация и регистрация флуоресцентных сигналов в конечной точке - 30 с при 60°С. Для проведения полимеразно-цепной реакции использовали Real-Time ДНК амплификатор «StepOnePlus» фирмы Applied Biosystems (США). Статистическая обработка результатов проводилась с использованием пакета программ SPSS для Windows, версия 15.0. Для проверки соответствия распределения частот генотипов исследуемого гена равновесному распределению Харди-Вейнберга использовался модифицированный критерий χ². Сравнение частот генотипов и аллелей анализируемых групп проводили с помощью критериев χ2, Фишера. Различия считали достоверными при р < 0,05.

Результаты исследования и их обсуждение

Результаты исследования гена нейротрофического фактора мозга BDNF представлены в табл. 1. Как видно из таблицы, распределение частот генотипов в исследованных группах соответствует распределению Харди-Вайнберга. В обследованных группах наиболее частым генотипом был Val/Val, в группе лиц с депрессией частота этого генотипа составила 67%, во второй группе у лиц с депрессией и соматическим заболеванием - 75,3%, в группе контроля - 67,1% соответственно. Вторым по частоте встречаемости был гетерозиготный генотип Val/Met (33; 23,5 и 30,6% соответственно). Наиболее редким был гомозиготный генотип Met/Met. В группе пациентов с депрессивными расстройствами этот генотип не обнаружен, в выборке больных депрессивными и коморбидными сердечно-сосудистыми заболеваниями генотип Met/Met составил 1,2%, в группе психически и соматически здоровых людей - 2,3%. По частоте встречаемости аллелей во всех исследуемых группах преобладал аллель Val, так в группе лиц с депрессивными расстройствами частота этого аллеля составила 83,6%, в группе больных депрессивными и коморбидными сердечно-сосудистыми заболевания- ми - 87%, в выборке здоровых людей - 82,5%. Минорный аллель Met в группе пациентов с депрессивными расстройствами составил 16,4%, среди больных депрессией и соматическими заболеваниями - 13%, в группе психически здоровых лиц этот аллель составил 17,5%.

Таблица 1

Распределение частот генотипов гена мозгового нейротрофического фактора (BDNF) и соответствие распределению Харди - Вайнберга (χ2) в исследуемых группах

Исследуемые группы

N

Генотипы

Аллели

Val/Val, %

Val/Met, %

Met/Met, %

Val, %

Met, %

Пациенты с депрессивными расстройствами

70

47 (67)

23 (33)

0

117 (83,6)

23 (16,4)

χ2 = 1,276; P = 0,259

Пациенты с депрессивными и сердечно-сосудистыми заболеваниями

81

61 (75,3)

19 (23,5)

1 (1,2)

141 (87)

21 (13)

χ2 = 0,006; P = 0,939

Психически и соматически здоровые лица

134

90 (67,1)

41 (30,6)

3 (2,3)

221 (82,5)

47 (17,5)

χ2 = 0,44; Р = 0,502

Примечание: N - число обследованных, в скобках - частота встречаемости,%.

Сравнительный анализ распределения частот генотипов полиморфного маркера исследуемого гена BDNF (рис. 1) не выявил статистических различий в частотах генотипов между двумя группами больных депрессивными расстройствами (χ2 = 2,407; Р = 0,3). Не было выявлено статистических различий распределения генотипов между группой пациентов с депрессивными расстройствами и контролем (χ2 = 1,642; Р = 0,44). При статистическом анализе частот генотипов среди группы контроля и выборки кардиологических больных с депрессивной симптоматикой не было выявлено значимых различий (χ2 = 1,673; Р = 0,433).

Рис. 1. Сравнительный анализ распределения частот генотипов мозгового нейротрофического фактора (BDNF) в исследуемых группах

Оценка распределения частот аллелей гена BDNF между исследуемыми выборками (рис. 2) также не выявила различий в частоте встречаемости полиморфизма Val66Met гена BDNF (между двумя группами больных депрессивными расстройствами χ2 = 0,473; Р = 0,492; между группой пациентов с депрессивными расстройствами и группой контроля χ2 = 0,021; Р = 0,88; между группой здоровых людей и кардиологическими пациентами с депрессивной симптоматикой χ2 = 1,262; Р = 0,28).

Рис. 2. Сравнительный анализ распределения частот аллелей мозгового нейротрофического фактора (BDNF) в исследуемых группах

Таким образом, при исследовании полиморфизма Val66Met гена BDNF выявлена тенденция к снижению частоты встречаемости гомозиготного генотипа Met/Met и аллеля Met среди пациентов с депрессивными расстройствами по сравнению с психически здоровыми людьми. По литературным данным известно, что гетерозиготы и гомозиготы по аллелю Met составляют 30-50% различных популяций, причем гомозиготы встречаются редко и в европейской популяции составляют всего 4%. Важно также отметить, что наличие генотипа Met/Met и минорного аллеля Met связано со снижением синаптической активности и пластичности в гиппокампе, что приводит к снижению секреции BDNF, предположительно приводящей к формированию депрессии [3]. В нашем исследовании все гомозиготы по аллелю Met, как среди здоровых лиц, так и среди пациентов, мужчины. В работе M. Verhagen et al. [13] указано, что генотип Met/Met может быть ассоциирован с мужским полом. На уровне морфологии мозга у носителей аллеля Met обнаружено уменьшение объемов дорсолатеральной префронтальной коры и гиппокампа [12]. В исследовании Pezawas L. [11] было отмечено, что у носителей аллеля Met менее выражены предрасположенность к депрессии, агрессивности, суицидальному поведению, однако, эти качества ассоциированы с генами серотониновой системы [8]. В проведенных нами ранее исследованиях [6] показана ассоциация локуса Т102С гена рецептора серотонина типа 2А 5-HTR2A с расстройствами адаптации с преобладанием депрессивных реакций. Однако существуют данные, свидетельствующие об ассоциации аллеля Val полиморфизма Val66Met с тревогой и депрессией [11]. Генотипирование по исследуемому локусу показало, что частота аллеля Val выше в группе пациентов с депрессивными и коморбидными сердечно-сосудистыми заболеваниями, чем частота этого аллеля у больных депрессивными расстройствами и психически здоровых лиц (87, 83,6 и 82,5% соответственно), что, вероятно, подтверждает данные об утяжелении течения и ухудшении прогноза депрессивных расстройств при наличии сопутствующей сердечно-сосудистой патологии [7]. Можно предположить, что нарушения в нейротрофической системе, вызванные генетическими мутациями, приводят к ухудшению нейропластичности и повреждению мозговых структур, связанных как с патофизиологией депрессии (гиппокамп), так и с произвольным контролем поведения (префронтальная кора) [5].

Заключение

В результате нашего исследования выявлена тенденция к снижению частоты встречаемости аллеля Met и гомозиготного генотипа Met/Met гена нейротрофического фактора мозга BDNF среди пациентов с депрессивными расстройствами по сравнению с группой психически и соматически здоровых людей. Наши данные согласуются с результатами исследований, проведенных в последние годы, и подтверждают участие нейротрофической системы в патогенезе аффективных расстройств, однако, вероятно, полиморфизм локуса гена BDNF влияет на поведение человека и развитие депрессивных расстройств через другие механизмы и системы, в том числе с участием серотонинергической системы.

Рецензенты:

  • Балашов П.П., д.м.н., профессор, зав. кафедрой психиатрии, наркологии, психотерапии, Гоу впо «Сибирский государственный медицинский университет» Министерства здравоохранения и социального развития Российской Федерации, г. Томск;
  • Куликова Н.В., д.м.н., профессор кафедры безопасности жизнедеятельности ФГБОУ ВПО «Томский государственный педагогический университет Министерства образования и науки РФ», г. Томск.

Работа поступила в редакцию 20.04.2012